Petrou, Eleni L. (ORCID: 0000-0001-7811-9288) Brandt, Colette D. Farley, Sean D. (ORCID: 0000-0003-3950-9958) Spivey, Timothy J. (ORCID: 0000-0003-2735-2770) Gruenthal, Kristen (ORCID: 0000-0002-1985-5071) Stantorf, Cory Battle, David McKeeman, Cherie M. (ORCID: 0000-0001-9868-2502) Ramey, Andrew M. (ORCID: 0000-0002-3601-8400) 20250304 tabular digital data Anchorage, Alaska U.S. Geological Survey, Alaska Science Center Suggested Citation: Petrou, E.L., Brandt, C.D., Farley, S.D., Spivey, T.J., Gruenthal, K., Stantorf, C., Battle, D., McKeeman, C.M., Ramey, A.M., 2025. Genetic data used to develop a genotyping-in-thousands by sequencing (GT-seq) panel for identifying individuals and estimating relatedness in Alaska black bears (Ursus americanus): U.S. Geological Survey data release, https://doi.org/10.5066/P1DIDUPX https://doi.org/10.5066/P1DIDUPX This data package includes genotype data for two independent sets of American black bear (Ursus americanus) samples. The first set of samples was collected from 85 adult bears harvested by permitted hunters in southcentral Alaska from 1994-2019; we hereafter refer to these as "hunter-harvested" samples. These hunter-harvested samples were genotyped with restriction site-associated sequencing (RAD-seq) and were used to detect sequence variants (microhaplotypes and SNPs) with high heterozygosity in Alaska bear populations, and design primers for 'genotyping-in-thousands by sequencing' (GT-seq). The second set of samples includes 79 of the hunter-harvested samples, as well as 84 additional samples collected from adult and juvenile bears on the Joint Base Elmendorf-Richardson (JBER) in Anchorage, Alaska, from 2020 to 2022. These samples were genotyped at 170 microhaplotype loci using GT-seq. The identification of individuals and relatives is important to natural resource management, as genetic mark-recapture surveys are frequently used to estimate the size and demographic parameters of harvested populations. In this study, we sequenced American black bears (Ursus americanus) collected from Alaska with restriction site-associated DNA sequencing (RAD-seq) to develop a panel of SNP and microhaplotype loci for the high-throughput genetic identification of individuals and first-order relatives. 1994 2022 observed Complete None planned Southcentral Alaska -153.5449 -140.9766 63.8987 58.9500 USGS Metadata Identifier USGS:66a114aed34ef32deb7edc7e ISO 19115 Topic Category Biota Environment NASA GCMD Earth Science Keyword Thesaurus Animals/Vertebrates Mammals Carnivores Bears USGS CSA Biocomplexity Thesaurus Population Genetics USGS Thesaurus Wildlife Genetics Genetic diversity DNA sequencing NIH MeSH Thesaurus DNA sequencing Genomics Genotype Alleles None Ursus americanus American Black Bear USGS Geographic Names Information System (GNIS) Alaska None Ursus americanus American Black Bear ITIS Integrated Taxonomic Information System Unknown online database online ITIS-North America Taxonomic details retrieved March 4, 2024 from the Integrated Taxonomic Information System online database https://www.itis.gov https://doi.org/10.5066/F7KH0KBK Species were identified by skilled observers in the field based on general appearance. Taxonomy is complete for all samples. Kingdom Animalia Subkingdom Bilateria Infrakingdom Deuterostomia Phylum Chordata Subphylum Vertebrata Infraphylum Gnathostomata Superclass Tetrapoda Class Mammalia Subclass Theria Infraclass Eutheria Order Carnivora Suborder Caniformia Family Ursidae Genus Ursus Species Ursus americanus American Black Bear TSN: 180544 No access constraints. No use constraints. These data are marked with a Creative Common CC0 1.0 Universal License and are in the public domain. It is requested that this USGS data release be cited for any subsequent publications that reference or utilize these data. Users are advised to read the dataset's metadata thoroughly to understand appropriate use and data limitations. U.S. Geological Survey, Alaska Science Center Mailing and Physical

4210 University Drive

Anchorage Alaska 99508 USA 907-786-7000 gs-ak_asc_datamanagers@usgs.gov University of Oregon Genomics and Cell Characterization Core Facility, Alaska Department of Fish and Game Gene Conservation Laboratory, and the Genetics Program at the Alaska Fisheries Science Center - Auke Bay Laboratories. Petrou, E.L. Brandt, C.D. Spivey, T.J. Gruenthal, K.M. McKeeman, C.M. Farley, S.D. Battle, D. Stantorf, C. Ramey, A.M. 2025 journal article Ecology and Evolution 15(4):e71273 online Wiley Petrou, E.L., Brandt, C.D., Spivey, T.J., Gruenthal, K.M., McKeeman, C.M., Farley, S.D., Battle, D., Stantorf, C., Ramey, A.M., 2025. Development of a genotyping-in-thousands by sequencing (GT-seq) panel for identifying individuals and estimating relatedness among Alaska black bears. Ecology and Evolution 15(4):e71273. https://doi.org/10.1002/ece3.71273 https://doi.org/10.1002/ece3.71273 For all samples, individual sample IDs, collection dates, sampling locations, and other values were cross-checked and verified with field worksheets. To minimize the risk of contamination, we sterilized equipment and plastics with UV light, used filter tips on pipettes, and utilized separate rooms for sample preparation and amplification. To identify possible sources of DNA contamination, we included negative controls (i.e., no-template controls) when conducting DNA extraction and GT-seq library preparation. Attribute values fall within expected ranges and data were proofed for the presence of duplication and omission. In addition, we estimated genotyping error rates by sequencing nine samples in replicate using GT-seq. Missing genotypes are represented by './.' FIELD: Samples used for SNP discovery were collected from adult bears harvested by permitted hunters in southcentral Alaska from 1994-2019. The samples were collected from several Game Management Units (GMUs) defined by the Alaska Department of Fish and Game, including the Anchorage Bowl, Kenai Peninsula, and Prince William Sound. Following harvest, a tooth was collected from each bear skull and stored at 4°C until DNA was extracted. Samples used for GT-seq panel testing and validation were collected from adult and juvenile bears on the Joint Base Elmendorf-Richardson in Anchorage, Alaska, from 2020 to 2022. These samples were non-lethal biopsies of skin tissue collected from the feet of bears using a Pneu-Dart biopsy dart gun and preserved in Longmire's Buffer at 4°C. Unknown LAB: Description of restriction site-associated DNA sequencing (RAD-seq): We extracted DNA from tooth samples using a NucleoSpin 96 Tissue kit (Macherey-Nagel) protocol. To prepare DNA for restriction site-associated DNA sequencing (RAD-seq), we followed a slightly modified version of the Ali et al. (2016) protocol which excluded the targeted bait capture step. In brief, 200 ng of DNA from each individual was digested using the restriction enzyme SbfI, and individually-barcoded i5 adaptors were ligated to each sample. Following this, an equal volume of each sample was pooled into libraries, which were sheared on a Q500 sonicator (Qsonica, Newtown, CT) for 12 to 14 cycles of 30 sec each. Libraries were subsequently purified with Dynabeads M-280 streptavidin magnetic beads (Invitrogen, Waltham, MA) and Ampure XP beads following Ali et al. (2016). DNA was eluted in 55.5 μL of low-TE buffer and used as input for the NEBNext Ultra DNA Library Prep Kit (NEB), following manufacturer's instructions and using size-selection parameters for a 250 bp DNA insert. The final pooled RAD-seq library was sequenced in conjunction with pooled libraries from three other species on an Illumina NovaSeq 6000 S4 flow cell (2 x 150bp) at the University of Oregon Genomics and Cell Characterization Core Facility. Description of genotyping-in-thousands by sequencing (GT-seq): DNA was extracted from biopsy samples using the DNeasy Blood and Tissue kit (Qiagen) and quantified with a Qubit fluorometer (Thermo Fisher Scientific). We normalized samples to a concentration of 20 ng/μL and prepared GT-seq libraries using the protocol of Campbell et al. (2015). The final fragment size distributions of GT-seq libraries were quantified with an Agilent ScreenTape device using High Sensitivity D1000 reagents. Each GT-seq library contained approximately 90 samples and was sequenced on an Illumina NextSeq 1000 instrument using a P1 flow cell (paired-end sequencing, 300 cycles), with the addition of 30% PhiX to ensure library complexity. Unknown DATA TRANSFORMATIONS: Genotyping samples sequenced with RAD-seq: Individual samples were demultiplexed using the process_radtags program in Stacks v.2.60 (Catchen et al. 2013), low quality sequences were removed (using the options --quality, --filter_illumina, and --clean), and sequences were trimmed to a length of 140 base pairs. Subsequently, sequences were aligned to the black bear genome (NCBI RefSeq Assembly: GCF_020975775.1, Srivastava et al. 2019) using the --very-sensitive option in bowtie2 v.2.3.5.1 (Langmead and Salzberg 2012). Successfully paired reads were retained and filtered for mapping quality (mapq > 20) with samtools v.1.9 (Li et al. 2009), and sequences were realigned around indels using GATK3 v.3.8. We genotyped samples and removed PCR duplicates using the gstacks program in Stacks. To ensure that only high-quality variants were included in the data, SNPs were filtered for minor allele count (--min-mac 3) and assessed for Hardy-Weinberg Equilibrium in each sample collection using the populations program in Stacks. SNPs were retained if they were sequenced in all sample collections (i.e., Game Management Units) and genotyped in more than 80% of individuals. Additional SNP filtering was done with VCFtools v.0.1.16 (Danecek et al. 2011) to remove SNPs with low mean sequencing depth (--min-meanDP 10) and retain SNPs with a minor allele frequency (MAF) > 0.05 over all samples. Following Petrou et al. (2019), we screened individuals for intraspecific DNA contamination by calculating individual multilocus heterozygosity (HI). Samples were removed from the data set if they had HI values greater than two standard deviations from the mean HI calculated over all samples. Genotyping samples sequenced with GT-seq: Microhaplotype genotypes were called at each amplicon following the method of Delomas et al. (2023) that is implemented in the software microTyper (available at https://github.com/delomast/microTyper). As input, this program requires a catalog of known SNP variants and individual sequences that have been aligned to GT-seq amplicons. First, adapters were trimmed from sequencing reads using Trimmomatic v.0.39 (Bolger et al. 2014), and forward reads were aligned to the GT-seq amplicons using bowtie2 (Langmead and Salzberg 2012). Aligned sequences were sorted, indexed, and filtered for mapping quality (-q 30 and -F 4) using samtools v.1.19 (Li et al. 2009). Genotype likelihoods were calculated using the mpileup command and SNPs were genotyped using the call command and consensus-caller model in bcftools v.1.19 (Danecek et al. 2021). We subsequently tested SNPs for deviations from Hardy-Weinberg equilibrium in the hunter-harvested samples, using the exact test based on Monte Carlo permutations of alleles (Guo and Thompson 1992) that is implemented in the R package pegas v. 1.3. (Paradis 2010). If a locus was out of HWE in all sample collections (i.e., GMUs), it was filtered from the catalog of variants. Finally, we used microTyper to call microhaplotype genotypes for every individual at GT-seq loci whose sequencing depth was greater than 20 reads. To remove confounded genotypes caused by processes such as index switching or genotyping error, we filtered haplotypes with an allelic read depth ratio of < 0.4, following Baetscher et al. (2019). Individuals with more than 20% missing genotypes were removed from downstream analyses. Unknown LITERATURE CITED: Ali, O.A., O'Rourke, S.M., Amish, S.J., Meek, M.H., Luikart, G., Jeffres, C., Miller, M.R., 2016. RAD Capture (Rapture): Flexible and Efficient Sequence-Based Genotyping. Genetics 202(2):389–400, https://doi.org/10.1534/genetics.115.183665 Baetscher, D.S., Anderson, E.C., Gilbert-Horvath, E.A., Malone, D.P., Saarman, E.T., Carr, M.H., Garza, J.C., 2019. Dispersal of a nearshore marine fish connects marine reserves and adjacent fished areas along an open coast. Molecular Ecology 28(7):1611-1623, https://doi.org/10.1111/mec.15044 Bolger, A.M., Lohse, M., Usadel, B., 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30(15):2114-2120, https://doi.org/10.1093/bioinformatics/btu170 Campbell, N.R., Harmon, S.A., Narum, S.R., 2015. Genotyping-in-Thousands by sequencing (GT-seq): a cost effective SNP genotyping method based on custom amplicon sequencing. Molecular Ecology Resources 15(4):855-867, https://doi.org/10.1111/1755-0998.12357 Catchen, J., Hohenlohe, P.A., Bassham, S., Amores, A., Cresko, W.A., 2013. Stacks: an analysis tool set for population genomics. Molecular Ecology 22(11):3124-3140, https://doi.org/10.1111/mec.12354 Danecek, P., Auton, A., Abecasis, G., Albers, C.A., Banks, E., DePristo, M.A., Handsaker, R.E., Lunter, G., Marth, G.T., Sherry, S.T., McVean, G., Durbin, R., 1000 Genomes Project Analysis Group, 2011. The variant call format and VCFtools. Bioinformatics 27(15):2156-2158, https://doi.org/10.1093/bioinformatics/btr330 Danecek, P., Bonfield, J.K., Liddle, J., Marshall, J., Ohan, V., Pollard, M.O., Whitwham, A., Keane, T., McCarthy, S.A., Davies, R.M., Li, H., 2021. Twelve years of SAMtools and BCFtools. GigaScience 10(2):giab008, https://doi.org/10.1093/gigascience/giab008 Delomas, T.A., Struthers, J., Hebdon, T., Campbell, M.R., 2023. Development of a microhaplotype panel to inform management of gray wolves. Conservation Genetics Resources 15:49-57, https://doi.org/10.1007/s12686-023-01301-x Guo, S.W., Thompson, E.A., 1992. Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48(2):361–372, https://doi.org/10.2307/2532296 Langmead, B., Salzberg, S.L., 2012. Fast gapped-read alignment with Bowtie 2. Nature Methods 9:357-359, https://doi.org/10.1038/nmeth.1923 Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., 1000 Genomes Project Data Processing Subgroup, 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25(16):2078-2079, https://doi.org/10.1093/bioinformatics/btp352 Paradis, E., 2010. pegas: an R package for population genetics with an integrated–modular approach. Bioinformatics 26(3):419–420, https://doi.org/10.1093/bioinformatics/btp696 Petrou, E.L., Drinan, D.P., Kopperl, R., Lepofsky, D., Yang, D., Moss, M.L., Hauser, L., 2019. Intraspecific DNA contamination distorts subtle population structure in a marine fish: decontamination of herring samples before restriction-site associated sequencing and its effects on population genetic statistics. Molecular Ecology Resources 19(5):1131-1143, https://doi.org/10.1111/1755-0998.12978 Srivastava, A., Sarsani, V.K., Fiddes, I., Sheehan, S.M., Seger, R.L., Barter, M.E., Neptune-Bear, S., Lindqvist, C., Korstanje, R., 2019. Genome assembly and gene expression in the American black bear provides new insights into the renal response to hibernation. DNA research 26(1):37-44, https://doi.org/10.1093/dnares/dsy036 Unknown General location names represent broadly defined areas of Alaska, they do not describe precise geographic points. Game Management Units (GMUs) are areas defined by the Alaska Department of Fish and Game. Point 0.000001 0.000001 Decimal degrees World Geodetic System of 1984 (WGS84) World Geodetic System of 1984 (WGS84) 6378137 298.257223563 blackBear_sampleData_southcentralAlaska_petrou.csv Table with identifying and collection information for 167 American black bears from southcentral Alaska. Presented in a Comma Separated Value (CSV) formatted table. Author defined Indiv Unique identifier of each sample. Corresponds to the "Indiv" identifier in all tables included with this data release. Author defined Unique identifier of each sample. FieldID Unique identifier of each sample used by the original collector. Blank cells indicate that there is no field ID. Author defined Unique identifier of each sample used by the original collector. Species Species Author defined Ursus americanus Scientific name for American black bear Author defined TissueType The type of tissue from which genetic material was extracted. Author defined tooth Tooth from hunter-harvested samples. Author defined skin biopsy Skin biopsy collected by biologists. Author defined SampleDate Date when the sample was collected in the field. Author defined 1990-05-03 2022-08-25 Date (YYYY-MM-DD) GameManagementUnit Game Management Unit (GMU), geographic areas defined by the Alaska Department of Fish and Game, where the sample was collected. Author defined Game Management Unit (GMU) locations as defined by the Alaska Department of Fish and Game. GeneralLocation Geographic areas in southcentral Alaska, where the sample was collected. Author defined Geographic areas in southcentral Alaska. State State where the sample was collected. Author defined Alaska Sample collected in Alaska. Author defined HunterReportedSex Sex of the bear as reported provided to the Alaska Department of Fish and Game by the hunter who harvested the bear. Blank cells indicate that sex was not recorded. Author defined M Male Author defined F Female Author defined SRYSex The genetic sex identification based on the SRY locus located on the Y chromosome.The sex of each individual was determined by counting the number of SRY amplicons in each FASTQ sequence file. As this gene is specific to the Y chromosome, males were defined as individuals who had more than 0.01% of total reads aligning to the SRY locus. NA indicates missing data. Author defined M Male Author defined F Female Author defined blackBear_genotypesGTseqMicrohap_southcentralAlaska_petrou.csv Table with GT-seq microhaplotype genotypes for 163 black bears collected from southcentral Alaska (comprised of 79 hunter-harvested samples, 1994-2019; 84 non-lethal biopsy samples from Joint Base Elmendorf-Richardson, 2020-2022). Data include sample IDs, genotypes for 170 GT-seq loci, and allele counts for those loci. Presented in a Comma Separated Value (CSV) formatted table. Author defined Indiv Unique identifier of each black bear sample. Author defined Unique identifier of each black bear sample. Locus Unique identifier of the DNA locus genotyped with GT-seq. Author defined Unique identifier of the DNA locus genotyped with GT-seq. SampleType Describes how the sample was acquired. Author defined Hunter-harvested Lethally sampled by hunters. Author defined Biopsy Non-lethal biopsy sample collected by biologist. Author defined Allele1 Nucleotide of the first single nucleotide polymorphism (SNP) or microhaplotype allele, represented by IUPAC nucleotide codes. A microhaplotype is defined as a genetic marker that contains two or more SNPs on the same sequence read. Diploid organisms have two alleles at each locus. If Allele2 matches Allele1, that individual is a homozygote. If Allele2 does not match Allele1, the individual is a heterozygote. NA indicates that there is no data for the sample. Author defined Nucleotide of the first microhaplotype allele. Allele2 Nucleotide of the second microhaplotype allele, represented by IUPAC nucleotide codes. Diploid organisms have two alleles at each locus. If Allele2 matches Allele1, that individual is a homozygote. If Allele2 does not match Allele1, the individual is a heterozygote. NA indicates that there is no haplotype data for the sample. Author defined Nucleotide of the first microhaplotype allele. Allele1_count Number of sequences representing Allele1. For homozygotes, this value is the same as Allele2. NA indicates that there is no haplotype data for the sample. Author defined 7 21770 Allele2_count Number of sequences representing Allele2. For homozygotes, this value is the same as Allele1. NA indicates that there is no haplotype data for the sample. Author defined 9 21770 blackBear_genotypesRADseq_southcentralAlaska_petrou.vcf Table with RAD-seq genotype information for 85 black bears sampled in southcentral Alaska, 1994-2019. Presented in a Variant Call Format (VCF) file (a standard text file format used in bioinformatics) The file begins with 2227 'header' rows that provide metadata describing the body of the file. Header rows start with a #. Author defined 'header' rows 1-2215 Unique identifier of the continuous genomic sequences (contigs) included in the table (one row for each contig). Corresponds with the "CHROM" column in the table. Author defined Unique identifier of the contigs included in the table. 'header' rows 2216-2227 Attribute metadata for the table. Author defined Attribute metadata for the table. CHROM Unique identifier of the genomic sequence (contig) or chromosome on which the variation is observed (corresponds with the contig IDs in the header rows). Author defined Unique identifier of the contig. POS The 1-based position of the variation on the contig. Author defined The 1-based position of the variation on the contig. ID Unique identifier of the variable site. In this dataset, this was automatically generated by the software STACKS. STACKS software Unique identifier of the variable site. REF Nucleotide observed in the reference genome, coded using IUPAC nucleotide codes. Author defined Nucleotide observed in the reference genome. ALT Additional nucleotide variant observed in the data, coded using IUPAC nucleotide codes. Author defined Additional nucleotide variant observed in the data. QUAL This column was automatically generated by STACKS software and only contains the value: ".". We retain the column to maintain the standard VCF format. Author defined Automatically generated by STACKS software and only contains the value: ".". FILTER Filter status: PASS if this position has passed all filters, i.e., a call is made at this position. Author defined Filter status: PASS if this position has passed all filters, i.e., a call is made at this position. INFO An extensible list of key-value pairs (fields) describing the variation. See below for fields used. Multiple fields are separated by semicolons. Author defined NS Number of Samples With Data STACKS software AF Allele Frequency STACKS software FORMAT An extensible list of fields for describing each sample and genotype. Multiple fields are separated by colons ":". Author defined GT Genotype; encoded as allele values separated by '/'. For example, 0/0 = homozygous for REF allele; 0/1 = heterozygous; 1/1 = homozygous for ALT allele STACKS software DP Read depth at this position for this sample. STACKS software AD Allele depth; number of sequences observed for each allele STACKS software GQ Conditional genotype quality; encoded as a phred quality −10log10 probability (genotype call is wrong, conditioned on the site's being variant). STACKS software GL Genotype likelihoods comprised of comma separated floating point log10-scaled likelihoods for all possible genotypes given the set of alleles defined in the REF and ALT fields. STACKS software UAM07Z17_80 through UAM15C19_97 These 85 columns contain genotype information for the 85 individual black bear samples. Column labels are the sample IDs. Data is formatted as defined in the previous column (FORMAT) Author defined Genotype information for the 85 individual black bear samples. blackBear_primersGTseq_southcentralAlaska_petrou.csv Table sequence information for GT-seq primers developed in this study. Presented in a Comma Separated Value (CSV) formatted table. Author defined ShortLocusName Unique identifier of each locus. Author defined Unique identifier of each locus. AmpliconPosition The genomic coordinates (ScaffoldName:SeqStart-SeqEnd) of the amplicon on the black bear genome (NCBI RefSeq Assembly: GC00F_020975775.1). Author defined The genomic coordinates (ScaffoldName:SeqStart-SeqEnd) of the amplicon. FocalSNP The genomic coordinates of the focal high-heterozygosity SNP. Author defined The genomic coordinates of the focal high-heterozygosity SNP. GTseq_PCR1_forward_primer_5to3 Amplicon-specific primers. Forward Primer Structure: 5'-[ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG][amplicon forward primer]-3' Author defined Amplicon-specific primers - forward. GTseq_PCR1_reverse_primer_5to3 Amplicon-specific primers. Reverse Primer Structure: 5'-[ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG][amplicon reverse primer]-3' Author defined Amplicon-specific primers - reverse. blackBear_ampliconsGTseq_southcentralAlaska_petrou.csv Table sequence information for GT-seq amplicons used in this study (UrsAm_locus1 - UrsAm_locus172), as well as the SRY sexing locus (MP-SRY_Ursus). Presented in a Comma Separated Value (CSV) formatted table. Author defined ShortLocusName Unique identifier of each locus. Author defined Unique identifier of each locus. AmpliconPosition The genomic coordinates (ScaffoldName:SeqStart-SeqEnd) of the amplicon on the black bear genome (NCBI RefSeq Assembly: GCF_020975775.1). Author defined The genomic coordinates (ScaffoldName:SeqStart-SeqEnd) of the amplicon. AmpliconSequence The amplicon sequence. SNPs are coded using IUPAC Ambiguity Codes for Nucleotide Degeneracy. Author defined The amplicon sequence. U.S. Geological Survey USGS ScienceBase Team Mailing and Physical

Denver Federal Center, Building 810, Mail Stop 302

Denver Colorado 80225 USA 1-888-275-8747 sciencebase@usgs.gov The U.S. Geological Survey, Alaska Science Center is the authoritative source of these data, distributed by ScienceBase (a USGS Trusted Digital Repository). Unless otherwise stated, all data, metadata and related materials are considered to satisfy the quality standards relative to the purpose for which the data were collected. Although these data and associated metadata have been reviewed for accuracy and completeness and approved for release by the U.S. Geological Survey, no warranty expressed or implied is made regarding the display or utility of the data for other purposes or on all computer systems, nor shall the act of distribution constitute any such warranty. Any use of trade, firm, or product names is for descriptive purposes only and does not imply endorsement by the U.S. Government. CSV, TXT, VCD Tabular data in CSV format; genetic data in a Variant Call Format (VCF) file (a standard text file format used in bioinformatics); FGDC metadata in XML and HTML formats. https://doi.org/10.5066/P1DIDUPX None 20250414 U.S. Geological Survey, Alaska Science Center Mailing and Physical

4210 University Drive

Anchorage Alaska 99508 USA 907-786-7000 gs-ak_asc_datamanagers@usgs.gov FGDC Biological Data Profile of the Content Standard for Digital Geospatial Metadata (CSDGM) FGDC-STD-001.1-1999