Meredith Nevers Murulee Byappanahalli Dawn Shively 2018 spreadsheet Reston, VA U.S. Geological Survey https://doi.org/10.5066/F7H70F3D Data were collected as part of a study to identify sources of E. coli contamination at several beaches located in the Grand Calumet River Areas of Concern, located in northern Indiana on Lake Michigan, as well as in Illinois and Wisconsin on Lake Michigan. Water samples were collected at each site in Indiana three times a week for thirteen weeks and at each site in Illinois and Wisconsin. All samples were analyzed for E. coli bacteria (an indicator bacteria for fecal contamination) and species-specific molecular markers (microbial source tracking, MST), including human, gull, and dog. Presence of MST markers indicates a fecal source at that location associated with the target animal. Field conditions were recorded during each site visit (e.g., including air and water temp, wind speed and direction, rainfall, wave height, currents, observations). Water samples were analyzed in the laboratory for E. coli using defined substrate technology and for MST markers using quantitative polymerase chain reaction (qPCR) methods and also turbidity. Lat_long_v2 file includes information regarding sampling locations and their corresponding latitude and longitudes. The E coli_turbidity_v2 data include E. coli densities and turbidity measurements. Data from the qpcr_v4 file includes results from quantitative polymerase chain reaction (qPCR) method for detection of host-specific microbial source tracking markers. Data from SanitarySurvey includes ambient conditions measured in the field: water and air temperature, current speed and direction (eastward, westward, float method), wind direction and speed, wave height, rainfall, and cloud cover. Data from SanitarySurvey_birds included number of birds (gulls, geese, ducks, cormorants, etc.) counted on the beach and in the water. The PowerWater.pdf is the DNA extraction kits' user manual giving detailed instructions for use. These data were collected to examine potential sources of high concentrations of E. coli at shoreline locations within the Grand Calumet River Area of Concern (Indiana) and Illinois and Wisconsin using host-specific, DNA-based molecular markers. Additionally, at AOC locations, modified sanitary surveys were used; data were also used to evaluate the effectiveness of a gull deterrence program using trained canines. 20150611 20150904 ground condition Complete None planned -87.8172 -87.4220 42.7616 41.6414 ISO 19115 Topic Category environment USGS Thesaurus freshwater ecosystems water sampling polymerase chain reaction microbiology contamination and pollution environmental health (human) Great Lakes USGS Metadata Identifier USGS:5ea85e0e82cefae35a1fae4a Getty Thesaurus of Geographic Names Lake Michigan Grand Calumet River Producer Defined Area of Concern No data access constraints No data use constraints Meredith Nevers U.S. Geological, Great Lakes Science Center, Lake Michigan Ecological Research Station mailing

1574 Kemil Road N 300 E

Chesterton IN 46304 219-926-8336 x425 219-929-5792 mnevers@usgs.gov Indiana Department of Environmental Management for funding Bio-Rad CFX Manager 3.1 was used to obtain qPCR data Meredith B. Nevers Murulee N. Byappanahalli Dawn Shively Paul M. Buszka P. Ryan Jackson Mantha S. Phanikumar 2018 publication Journal of Environment Quality vol. 47, issue 5 n/a American Society of Agronomy ppg. 1042 https://doi.org/10.2134/jeq2017.11.0461 Julie Kinzelman M.N. Byappanahalli M.B. Nevers D. Shively S. Kurdas C. Nakatsu 202011 publication Journal of Microbiological Methods vol. 178 n/a Elsevier BV ppg. 106049 https://doi.org/10.1016/j.mimet.2020.106049 Meredith B. Nevers Paul M. Buszka Muruleedhara N. Byappanahalli Travis Cole Steven R. Corsi P. Ryan Jackson Julie L. Kinzelman Cindy H. Nakatsu Mantha S. Phanikumar 202204 publication Journal of Great Lakes Research vol. 48, issue 2 n/a Elsevier BV ppg. 441-454 https://doi.org/10.1016/j.jglr.2022.01.009 High standard quality assurance practices were employed in laboratory and field protocols to collect the data, ensuring the accuracy of values in datasets. All technicians collecting data undergo rigorous training to adhere to SOPs. Appropriate positive and negative controls were included in all qPCR assays and inhibition determination took place on 20% of the samples. All standard curve R-squared values and amplification efficiencies were inspected. Any questionable result was reanalyzed, if sample result was still questionable, the sample was not used in analysis. All standard curve R-squared values and amplification efficiencies fell within the expected ranges, water sample data did not have expected ranges. Datasets were checked for errors, including duplication or omission. All manually entered data by the technicians were checked for errors against hard copies of the data once. Data set is considered complete for the information presented, as described in the abstract. Users are advised to read the rest of the metadata record carefully for additional details. Coordinates were created from Google Earth or Google maps (WGS84) A formal accuracy assessment of the vertical positional information in the data set has either not been conducted, or is not applicable. Andrew D. Eaton Lenore S. Clesceri Eugene W. Rice Arnold E. Greenburg Mary Ann H. Franson 2005 publication Washington, DC American Public Health Association ISBN: 0875530478 9780875530475 n/a Digital and/or Hardcopy 2005 publication date American Public Health Association, 2005 Methodology used in processing step 1 Richard L. Whitman Meredith B. Nevers 200408 publication Environmental Science & Technology vol. 38, issue 16 n/a American Chemical Society (ACS) ppg. 4241-4246 https://doi.org/10.1021/es034978i Digital and/or Hardcopy 20040710 publication date Whitman and Nevers, 2004 Methodology used in step process 1 World Health Organization 19990301 publication Geneva, Switzerland World Health Organization Technical document: Government Document number WHO/SDE/WSH/99.1 https://www.who.int/water_sanitation_health/bathing/annapolis.pdf Digital and/or Hardcopy 19990301 publication date World Health Organization, 1999 Methodology used in processing step 1 Stephen C Edberg Martin J Allen Darrell B Smith 20200114 publication Journal of AOAC INTERNATIONAL vol. 74, issue 3 n/a Oxford University Press (OUP) ppg. 526-529 https://doi.org/10.1093/jaoac/74.3.526 Digital and/or Hardcopy 19910501 publication date Edberg, Allen et al, 1991 Methodology used in processing step 2 Linda K. Dick Michael T. Simonich Katharine G. Field 200506 publication Applied and Environmental Microbiology vol. 71, issue 6 n/a American Society for Microbiology ppg. 3179-3183 https://doi.org/10.1128/AEM.71.6.3179-3183.2005 Digital and/or Hardcopy 200506 publication date Dick, L., et al., 2005 Methodology used in processing step 3 John F. Griffith Blythe A. Layton Alexandria B. Boehm Patricia Holden Jennifer A. Jay Charles Hagedorn Charles D. McGee Steven B. Weisberg 20131201 publication Technical report 804 https://www.waterboards.ca.gov/water_issues/programs/beaches/cbi_projects/docs/sipp_manual.pdf Digital and/or Hardcopy 20131201 publication date Griffith, J. F., et al, 2013 Methodology used in processing step 3 Hyatt C. Green Richard A. Haugland Manju Varma Hana T. Millen Mark A. Borchardt Katharine G. Field William A. Walters R. Knight Mano Sivaganesan Catherine A. Kelty Orin C. Shanks 20140307 publication Applied and Environmental Microbiology vol. 80, issue 10 n/a American Society for Microbiology ppg. 3086-3094 https://doi.org/10.1128/AEM.04137-13 Digital and/or Hardcopy 20140307 publication date Green, Hyatt C., et al, 2014 Methodology used in processing step 3 C. Johnston J.A. Ufnar J.F. Griffith J.A. Gooch J.R. Stewart 20101112 publication Journal of Applied Microbiology vol. 109, issue 6 n/a Wiley ppg. 1946-1956 https://doi.org/10.1111/j.1365-2672.2010.04824.x Digital and/or Hardcopy 20101112 publication date Johnston, C., et al., 2010 Methodology used in processing step 3 Jingrang Lu Jorge W. Santo Domingo Regina Lamendella Thomas Edge Stephen Hill 20080701 publication Applied and Environmental Microbiology vol. 74, issue 13 n/a American Society for Microbiology ppg. 3969-3976 https://doi.org/10.1128/AEM.00019-08 Digital and/or Hardcopy 20080701 publication date Lu, J., J.W, 2008 Methodology used in processing step 3 C. Johnston J.A. Ufnar J.F. Griffith J.A. Gooch J.R. Stewart 20101112 publication Journal of Applied Microbiology vol. 109, issue 6 n/a Wiley ppg. 1946-1956 https://doi.org/10.1111/j.1365-2672.2010.04824.x Digital and/or Hardcopy 20101112 publication date Gentry-Shields, J. R., et al, 2012 Methodology used in processing step 3 Field Collections: Water samples were collected in triplicate 3 times a week for 13 weeks between 6/11/15 and 9/4/15. At each of four Indiana shoreline locations (HW, HE, WH, JP1 and JP2) and the Grand Calumet River (GC) and individual water samples at each of two Illinois (63-1 and 63-2) and four Wisconsin (N1-4) shoreline locations were collected 1 day a week between 6/11/15 and 8/20/15 Samples were collected using sterile Nalgene plastic bottles following protocols outlined in Standard Methods (American Public Health Association 2005), USGS protocols (Whitman and Nevers 2004), and Annapolis Protocol (World Health Organization 1999). Samples were collected in ~45 cm-deep water, 10 cm below the surface; GC samples were collected from an overhead bridge using a sterile bucket. Samples were transported to the laboratory in a cooler, on ice, and analyzed or filtered within 6 hr of collection. Sanitary surveys were performed at the IN shoreline locations, including ambient conditions and number of birds (gulls, geese, ducks, cormorants, etc.) in the water and on the beach. Citations: American Public Health Association. 2005. Standard Methods for the Examination of Water and Wastewater, 21st Edition. American Public Health Association, Washington, D.C. Whitman, R.L., and M.B. Nevers. 2004. Escherichia coli sampling reliability at a frequently closed Chicago beach: Monitoring and management implications. Environ. Sci. Technol. 38:4241-4246. World Health Organization. 1999. Health-based monitoring of recreational waters: The feasibility of a new approach (The "Annapolis Protocol") WHO/SDE/WSH/99.1. World Health Organization, Sustainable Development and Healthy Environments, Geneva. American Public Health Association, 2005 Whitman and Nevers, 2004 World Health Organization, 1999 20150904 Katarzyna Przybyla-Kelly U.S. Geological, Great Lakes Science Center, Lake Michigan Ecological Research Station Biological Technician mailing address

1574 Kemil Road N 300 E

Chesterton IN 46304 United States 219-926-8336 219-929-5792 kprzybyla-kelly@usgs.gov E. coli analysis: Water samples (generally 100 mL) were analyzed for E. coli using the IDEXX Colilert®-18 and Quanti-Tray® 2000 method (IDEXX Laboratories, Westbrook, Maine), a defined substrate technology (Edberg, Allen et al. 1991), with results provided as most probable number (MPN)/100 mL. Citation: Edberg, S.C., M.J. Allen, and D.B. Smith. 1991. Defined substrate technology method for rapid and specific simultaneous enumeration of total coliforms and Escherichia coli from water: Collaborative study. J. Assoc. Off. Anal. Chem. 74:526-529. Edberg, Allen et al, 1991 20150904 Dawn A Shively U.S. Geological, Great Lakes Science Center, Lake Michigan Ecological Research Station Biological Technician mailing address

1574 Kemil Road N 300 E

Chesterton IN 46304 United States 219-926-8336 x427 219-929-5792 dshively@usgs.gov qPCR for Microbial Source Tracking markers: All water samples (1000 mL) were pre-filtered through 5-µm nitrocellulose filters followed by a final filtration onto 0.22-µm nitrocellulose filters (EMD Millipore, Billerica, MA). The latter were placed in Mo Bio PowerWater® bead tubes (MO BIO Laboratories, Carlsbad, CA) and held at -80ºC until processing. The WI water samples were processed by City of Racine Health Department in a similar manner as the IL and IN samples and filters were frozen, shipped on ice overnight to USGS, and stored at -80°C until further processing. DNA was extracted directly using Mo Bio PowerWater® kit (MO BIO Laboratories, Carlsbad, California) according to instructions with one exception: final elution had two sequential additions (50 µL) of DNA elution buffer (PW6) for a final volume of 100 µL. DNA concentrations were measured by fluorometric quantitation (Qubit®, ThermoFisher Scientific, Waltham, MA). DNA extracts were used for the host-specific MST markers using the following primer/probe sets: Canine (DogBact, Dick, L. K. et. al. 2005; Griffith et. al., 2013): Forward: 5'- CGCTTGTATGTACCGGTACG, Reverse: 5'- CAATCGGAGTTCTTCGTG, and TaqMan® probe: [6-FAM]-5'- ATTCGTGGTGTAGCGGTGAAATGCTTAG- BHQ1; Gull (Gull2, Lu et al., 2008; Griffith et. al., 2013): Forward: 5'- TGCATCGACCTAAAGTTTTGAG, Reverse: 5'- GTCAAAGAGCGAGCAGTTACTA, and TaqMan® probe: [6-FAM]-5'- CTGAGAGGGTGATCGGCCACATTGGGACT-BHQ1; human (HF183, Green et. al., 2014): Forward: 5'- ATCATGAGTTCACATGTCCG, Reverse: 5'- CTTCCTCTCAGAACCCCTATCC, and TaqMan® probe: [6-FAM]-5'- CTAATGGAACGCATCCC-MGB; and human (Mnif, Johnston et. al., 2010; Gentry-Shields, et. al., 2012): Forward: 5'- GAAAGCGGAGGTCCTGAA, Reverse: 5'- ACTGAAAAACCTCCGCAAAC, and TaqMan® probe: [6-FAM]-5'- CCGGACGTGGTGTAACAGTAGCTA-BHQ1. Quantitative polymerase chain reaction assays were performed to quantify gene copies associated with targeted fecal sources using real-time PCR platform (Bio-Rad CFX Connect™ Real-time PCR Detection System, Bio-Rad, Hercules, California) in 96-well PCR plates with a reaction volume of 25 µl. For the Mnif assay, qPCR cycling conditions were acquired from two different studies, and an optimization step using a temperature gradient to determine optimal annealing was performed. For all assays, quantitation was determined from standard curves obtained from serial dilutions of gBlocks® Gene Fragments (Integrated DNA Technologies, Coralville, Iowa) specific to MST markers. Results for MST are reported as copy numbers (CN)/100 mL; where copy number is the number of DNA molecules in a cell. DNA extracts were randomly chosen (20%) and analyzed diluted and undiluted for each qPCR assay to determine inhibition; individual DNA extracts were diluted 5X, 10X, or 20X to achieve a concentration range of 2-5 ng total DNA. Samples were considered inhibited if Cq values (diluted and undiluted) were dissimilar relative to dilution. Lower limit of quantification (LLOQ) was determined for each qPCR assay and applied to all corresponding data; this was the average of at least two of the triplicate Cq values detected at the lowest concentration of the standard curve, and high reproducibility was observed. If a sample DNA Cq value was < LLOQ, it was considered within the range of quantification (ROQ); if it was > LLOQ, it was considered as detected but not quantifiable (DNQ) and was not included in statistical analysis. Citations: Dick, L.K., M.T. Simonich, and K.G. Field. 2005. Microplate subtractive hybridization to enrich for Bacteroidales genetic markers for fecal source identification. Appl. Environ. Microbiol. 71:3179-3183. Griffith, J. F., et al. (2013). The California Microbial Source Identification Manual: A Tiered Approach to Identifying Fecal Pollution Sources to Beaches, Technical Report 804, Southern California Coastal Water Research Project, Costa Mesa, CA. Lu, J., J.W. Santo Domingo, R. Lamendella, T. Edge, and S. Hill. 2008. Phylogenetic diversity and molecular detection of bacteria in gull feces. Appl. Environ. Microbiol. 74:3969-3976. Green, H. C., et al. (2014). "Improved HF183 quantitative real-time PCR assay for characterization of human fecal pollution in ambient surface water samples." Applied and Environmental Microbiology 80(10): 3086-3094. Gentry-Shields, J. R., Jakob G, Stewart, Jill R (2012). "HuBac and nifH source tracking markers display a relationship to land use but not rainfall." Water Research 46(18): 6163-6174. Johnston, C., et al. (2010). "A real‐time qPCR assay for the detection of the nifH gene of Methanobrevibacter smithii, a potential indicator of sewage pollution." Journal of Applied Microbiology 109(6): 1946-1956. Dick, L., et al., 2005 Griffith, J. F., et al, 2013 Green, Hyatt C., et al, 2014 Johnston, C., et al., 2010 Lu, J., J.W, 2008 Gentry-Shields, J. R., et al, 2012 20151202 Ashley M Spoljaric U.S. Geological, Great Lakes Science Center, Lake Michigan Ecological Research Station mailing address

1574 Kemil Road N 300 E

Chesterton IN 46304 United States 219-926-8336 219-929-5792 aspoljaric@usgs.gov Second Release of "Identify sources of high E. coli concentrations, beaches of southern Lake Michigan, 2015" of data release: Updated: 07/01/2020 First data release – (version 1.0, February 2018) Data amendment release – (version 2.0, July 2020) The data were updated in July of 2020 to include additional data collected during this project. Data included were E. coli and turbidity and microbial source tracking (MST). The associated metadata xml file was updated to match the current data version. All reference to the additional data have been updated in the Entity and Attribute, Identification, and Data Quality (Source inputs) sections. 20200701 Lat_Long_v2.csv This table contains information associated with sampling locations, including latitude and longitude. Producer defined Location_ID shortened location name representing the sampling locations Producer defined Indicates the Alphanumeric codes for sampling locations . Location_name Formal location name Producer defined Text field for formal location names for the sampling locations State State in which samples were collected Producer Defined Options are: WI, IL, and IN See table Lat_Long.csv for specific information Latitude Latitude in decimal degrees (WGS84) Producer defined Latitude for each location obtained from Indiana Beach Guard System (HW, HE, JP I and JP II) or Google Earth (WH, GC, JP1 and JP2, 63-1 and 63-2, and N1-N4) Longitude Longitude in decimal degrees (WGS84) Producer defined Longitude for each location obtained from Indiana Beach Guard System (HW, HE, JP I and JP II) or Google Earth (WH, GC, JP1 and JP2, 63-1 and 63-2, and N1-N4) Comments Additional information Producer defined pertinent additional sampling location information E coli-turbidity_v2.csv This table contains E. coli densities and turbidity values for each location. Producer defined Date Field sample collection date Producer defined Field samples collections took place between June 11 and September 4, 2015. Location_ID Sampling locations Producer defined See table Lat_Long.csv for specific information on these sampling locations. N locations present mean data that were collected between the N1 and N4 locations listed in the lat lon table. State State in which sample was collected Producer Defined Options are: WI, IL, and IN See table Lat_Long.csv for specific information Replicate Replicate number Producer defined During sample collections, triplicate water samples (1-3) were collected at each location. Turbidity Laboratory measured turbidity values Producer defined NA Sample not analyzed Producer defined 0.34 41.28 NTU Ecoli Culture-based E. coli measurements Producer defined 0.5 24420.0 MPN/100 mL Comments Additional sample information Producer defined Pertinent information regarding E. coli detection: E. coli values less than 1 were replaced with 0.5 qpcr_v4.csv This table contains data related to qPCR assay results. Producer defined Date Field sample collection date Producer defined Field samples collections took place between June 11 and September 4, 2015. Location_ID Sampling locations Producer defined See table Lat_Long.csv for specific information on these sampling locations State State in which samples were collected Producer Defined Options are: WI, IL, and IN See table Lat_Long.csv for specific information Replicate Replicate number Producer defined During sample collections, triplicate (IN, 1-3), or individual (1, WI, IL) water samples were collected at each location. qPCR_assay Target host-specific DNA marker Producer defined Dog: DogBact, canine-specific Gull2: Gull-specific HF183: Human-specific Mnif: human-specific Cq Quantification cycle. ND means "not detected" and refers to no target DNA detected in the qPCR assay. Producer defined The Cq is the quantification cycle or the cycle number in which the DNA fluorescence has increased above any background fluorescence. Starting_Quanitity_RX Starting quantity. ND means "not detected" and refers to no target DNA detected in the qPCR assay. Producer defined Initial amount of DNA present in each sample per amount of genomic DNA added to reaction mixture. CN Copy numbers or amount of target DNA present in sample water: CN/100 mL=SQ* (100 uL DNA eluted/2 uL DNA per rx)*(100 mL/x mL filtered). "0" represents target DNA below detectable limits. Producer defined 0.0 1251500.0 CN/100 mL Detection DNA marker detection status Producer defined DNQ: Detected but not quantifiable (below the limit of quantification) ND: Not detected ROQ: Detected within the range of quantification Statistical_analysis Sample use in statistical analysis Producer defined NA Data analysis not performed Producer defined No: Sample not used in statistical analysis Yes: Sample used in statistical analysis SanitarySurvey.csv This table contains sanitary survey data collected in conjunction with water sample collections. Producer defined Date Field sample collection date Producer defined Sanitary surveys were performed between June 11 and September 4, 2015. Location_ID Sampling locations Producer defined See table Lat_Long.csv for specific information on these sampling locations. Time Sampling time Producer defined Time in which sanitary surveys were performed (HH:MM AM) Air_Temp Field measured air temperature. NA=not measured. Producer defined NA Data not collected Producer defined 14.8 31.6 Degrees Celsius Water_Temp Field measured water temperature. NA=not measured. Producer defined NA Data not collected Producer defined 14.8 26.5 Degrees Celsius Wind_Spd Field measured wind speed. NA=not measured. Producer defined NA Data not collected Producer defined Wind speed measured with an anemometer. Ranged from 0/calm-8 m/s There are some zeros in the data file with a corresponding wind direction in the Wind_Dir column. While this may seem illogical, the winds were below the anemometer's detection limit, but field technicians were able to distinguish and record a wind direction. Wind_Dir Field measured wind direction. NA=not measured Producer defined NA Data not collected Producer defined Cardinal wind direction estimated by field technician. Calm in this column refers to no detectable wind direction. Sky_Cond Field measured sky conditions. NA=not measured. Producer defined NA Data not collected Producer defined Sky conditions describes the predominant sky condition (see below) related to cloud cover (next column), which is divided into eighths, of the sky covered by opaque clouds. Sky condition observed by field technician. Options: Sunny Mostly Sunny Partly Sunny Mostly Cloudy Cloudy Cloud_Cover Field measured cloud cover. NA=not measured. Producer defined NA Data not collected Producer defined Amount of cloud cover (fraction) estimated by field technicians. Options: No clouds 1/8-2/8 3/8-1/2 5/8-7/8 Total coverage Prior_Rain Previous rainfall. NA=not measured. Producer defined NA Data not collected Producer defined Rainfall previous to sample collection time, estimated by field technicians. Options: Less than 24, Less than 48, Less than 72, greater than 72 hours Wave_Hgt Field measured wave height. NA=not measured. Producer defined NA Data not collected Producer defined Wave height (inches) measured with meter stick by field technicians. At times, wave height could not be measure with a meter stick (waves too low or too high), therefore the values were estimated, specifically, less than 1, 28+, and 26+ inches were used. Current_Time Field measured current time: How long (seconds) it takes for a bobber placed in the middle of two field flags positioned in the water (45 cm depth) parallel to the shore and spaced 182 cm to reach a given flag (91 cm). NA=not measured and 0= no current. Producer defined NA Data not collected Producer defined 0.0 240.0 seconds Current_Spd Calculated current speed: 91 cm/Current_Time. NA=not measured and 0= no current. Producer defined NA Data not collected Producer defined 0.0 45.5 cm/s Current_Dir Field measured current direction. NA=not measured. Producer defined NA Data not collected Producer defined Direction in which bobber traveled when determining Current_Time; observed by field technician. Options: East, west, none Observations Field observations Producer defined General conditions observed by field technician at/near the study location. Information pertinent to sanitary conditions such as, trash, fecal droppings, shorebird feathers, location of shorebirds, algal accumulations, etc... Comments Additional information related to data collection Producer defined Pertinent field data collection information related to data collection SanitarySurvey_birds.csv This table contains shorebird count data recorded during sanitary surveys. Producer defined Date Sample collection date Producer defined Field samples collections took place between June 11 and September 4, 2015. Location_ID Sampling locations Producer defined See table Lat_Long.csv for specific information on these sampling locations. Gulls_water Number of gulls counted in the water Producer defined 0 46 Geese_water Number of geese counted in the water Producer defined 0 50 Ducks_water Number of ducks counted in the water Producer defined 0 2 Cormorant_water Number of cormorants counted in the water Producer defined 0 40 Total_water Sum of all shore birds counted in the water Producer defined 0 50 Gulls_beach Number of gulls counted on the beach. Producer defined 0 170 Geese_beach Number of geese counted on the beach Producer defined 0 46 Crane_beach Number of cranes counted on the beach Producer defined 0 1 Plover_beach Number of plovers counted on the beach Producer defined 0 5 Misc_beach Number of miscellaneous birds counted on the beach Producer defined 0 8 Total_beach Sum of all birds counted on the beach. On 6/18/15 at JP1, additional gulls were counted on the backshore side of the survey location and was added to Total_beach. Producer defined 0 170 Total_birds Sum of all birds counted on the beach and in the water. Producer defined 0 174 GS ScienceBase U.S. Geological Survey mailing address

Denver Federal Center, Building 810, Mail Stop 302

Denver CO 80225 United States 1-888-275-8747 sciencebase@usgs.gov Unless otherwise stated, all data, metadata and related materials are considered to satisfy the quality standards relative to the purpose for which the data were collected. Although these data and associated metadata have been reviewed for accuracy and completeness and approved for release by the U.S. Geological Survey (USGS), no warranty expressed or implied is made regarding the display or utility of the data for other purposes, nor on all computer systems, nor shall the act of distribution constitute any such warranty. Digital Data https://doi.org/10.5066/F7H70F3D None 20250401 Great Lakes Science Center mailing and physical

1451 Green Road

Ann Arbor MI 48105 US 734-994-3331 GS_ASK_GLSC@usgs.gov FGDC CSDGM FGDC-STD-001-1998 Record created using USGS Metadata Wizard tool. (https://github.com/usgs/fort-pymdwizard)