Catherine A. Fargen 2019 .txt Reston, VA U.S. Geological Survey https://doi.org/10.5066/P981QCF7 Groundwater and surface-water samples were collected and analyzed for microbial source tracking markers to identify the primary sources of fecal bacteria at a Lake Michigan beach in Northwestern Indiana. U.S. Geological Survey, through support provided by Great Lakes Restoration Initiative, investigated foreshore and adjacent backshore conditions as part of overall activities to characterize change in bacterial conditions in surface water at these beaches in response to implementation of best management practices. 20180426 20180625 ground condition Complete None planned -87.505 -87.503 41.692 41.69 Beach and lake at Whihala Beach County Park in Whiting, Indiana none Microbial source tracking Bacteriodes Catellicoccus marimmalium beach health human health nearshore bacteria USGS Metadata Identifier USGS:5bdf47bae4b0b3fc5cf33045 Geographic Names Information System (GNIS) Lake Michigan Northwest Indiana Whihala Beach Great Lakes Whiting, IN none none Travis R. Cole U.S. Geological Survey, Ohio-Kentucky-Indiana Water Science Center Hydrologist mailing and physical

5957 Lakeside Boulevard

Indianapolis Indiana 46278 United States 317-600-2768 tcole@usgs.gov Travis R. Cole, David C. Lampe, Dawn A. Shively, Meredith B. Nevers USGS Biocomplexity Thesaurus Viruses Integrated Taxonomic Information System (ITIS) 2018 ONLINE_REFERENCE Washington, D.C. Integrated Taxonomic Information System (ITIS) http://itis.gov Dawn A Shively U.S. Geological Survey, Lake Michigan Biology Station, Great Lakes Science Center Biological Technician mailing and physical

1574 Kemil Road N 300 E

Chesterton IN 46304 United States 219-926-8336 x427 dshively@usgs.gov genetic analysis Samples were considered inhibited if Cq values (diluted and undiluted) were dissimilar relative to dilution. Lower limit of quantification (LLOQ) was determined for each qPCR assay and applied to all corresponding data; this was the average of at least two of the triplicate Cq values detected at the lowest concentration of the standard curve, and high reproducibility was observed. If a sample DNA Cq value was > LLOQ, it was considered within the range of quantification (ROQ); if it was < LLOQ, it was considered as detected but not quantifiable (DNQ) and was not included in statistical analysis. Bacteria were identified to genus and/or species. Kingdom Bacteria Subkingdom Negibacteria Phylum Bacteroidetes Class Bacteroidia Order Bacteroidales Family Bacteroidaceae Genus Bacteroides Subkingdom Posibacteria Phylum Firmicutes Class Bacilli Order Lactobacillales Family Enterococcaceae Genus Catellicoccus Species marimammalium Data were analyzed by laboratory professionals at the U.S. Geological Survey, Lake Michigan Ecological Research Station, Great Lakes Science Center. Attribute values were marked as verified by Murulee Byappanahalli and Dawn Shively from the U.S. Geological Survey, Lake Michigan Ecological Research Station, Great Lakes Science Center. No formal logical accuracy tests were conducted Data set is considered complete for the information presented, as described in the abstract. Users are advised to read the rest of the metadata record carefully for additional details. No formal positional accuracy tests were conducted No formal positional accuracy tests were conducted Microbial Source Tracking data from 4/26/18 to 6/25/18 were organized in a spreadsheet and corresponding station names were added for this data release. Data were evaluated to ensure consistency in naming conventions and presentation of dates and times. 2018 both FIELD: Lake: Discrete-depth grab samples (3-feet below surface) were collected, and samples were preserved on ice, following the USGS standard protocols. Groundwater: After purging 3 well volumes with a peristaltic pump, bottles were filled and preserved on ice, following the USGS standard protocols. On 6/25/2018, previously sampled area of concern (AOC) sampling locations rather than the well transects locations were used in order to avoid duplicating sampling efforts on that day. This technique was justified since the study area was very small. LAB: All water samples (1000 mL) were pre-filtered through 5-µm nitrocellulose filters followed by a final filtration onto 0.22-µm nitrocellulose filters (EMD Millipore, Billerica, Mass.). Each filter was placed in separate Mo Bio PowerWater® bead tubes (MO BIO Laboratories, Carlsbad, Calif.) and held at -80ºC until processing. DNA from the pre and final filters was extracted together directly from the two filters using Mo Bio PowerWater® kit (MO BIO Laboratories, Carlsbad, Calif.) according to instructions with one exception: final elution had two sequential additions (50 µL) of DNA elution buffer (PW6) for a final volume of 100 µL. While the first three steps in the DNA extraction/purification are separate for each filter size, the DNA from both filters come together for the remaining steps, which yields one DNA sample. DNA concentrations were measured by fluorometric quantitation (Qubit®, ThermoFisher Scientific, Waltham, Mass.). DNA extracts were analyzed for the host-specific MST markers using the following primer/probe sets: Gull (Gull2, Lu and others, 2008; Griffith and others, 2013): Forward: 5'- TGCATCGACCTAAAGTTTTGAG, Reverse: 5'- GTCAAAGAGCGAGCAGTTACTA, and TaqMan® probe: [6-FAM]-5'- CTGAGAGGGTGATCGGCCACATTGGGACT-BHQ1 and human (HF183, Green and others, 2014): Forward: 5'- ATCATGAGTTCACATGTCCG, Reverse: 5'- CTTCCTCTCAGAACCCCTATCC, and TaqMan® probe: [6-FAM]-5'- CTAATGGAACGCATCCC-MGB. Quantitative polymerase chain reaction assays were performed to quantify gene copies associated with targeted fecal sources using real-time PCR platform (Bio-Rad CFX Connect™ Real-time PCR Detection System, Bio-Rad, Hercules, Calif.) in 96-well PCR plates with a reaction volume of 25µl. For all assays, quantitation was determined from standard curves obtained from serial dilutions of gBlocks® Gene Fragments (Integrated DNA Technologies, Coralville, Iowa) specific to MST markers. Results for MST are reported as copies per 100 mililiters (Copies/100 mL); where “copies” is the number of the MST marker. DNA extracts were randomly chosen (20 percent) and analyzed diluted and undiluted for each qPCR assay to determine inhibition; individual DNA extracts were diluted 5X, 10X, or 20X to achieve a concentration range of 2-5ng total DNA. Samples were considered inhibited if Cq values (diluted and undiluted) were dissimilar relative to dilution. Lower limit of quantification (LLOQ) was determined for each qPCR assay and applied to all corresponding data; this was the average of at least two of the triplicate Cq values detected at the lowest concentration of the standard curve, and high reproducibility was observed. If a sample DNA Cq value was < LLOQ, it was considered within the range of quantification (ROQ); if it was > LLOQ, it was considered as detected but not quantifiable (DNQ) and was not included in statistical analysis. Griffith, J.F. Layton, B.A. Boehm, A.B. Holden, P.A. Jay, J.A. Hagedom, C. McGee, C.D. Weisberg, S.B. 2013 Document https://www.waterboards.ca.gov/water_issues/programs/beaches/cbi_projects/docs/sipp_manual.pdf Green, H.C. Haugland, R.A. Varma, M. Millen, H.T. Borchardt, M.A. Field, K.G. Walters, W.A. Knight, R. Sivaganesan, M. Kelty, C.A. Shanks, O.C. 2014 Document https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4018914/pdf/zam3086.pdf Gentry-Shields, J. Rowny, J.G. Stewart, J.R. 2012 Document https://www.sciencedirect.com/science/article/pii/S0043135412006598?via%3Dihub Lu, J. Santo Domingo, J.W. Lamendella, R. Edge, T. Hill, S. 2008 Document https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2446513/ NWIS database for site locations (latitude and longitude) Point Microbial Source Tracking_data.txt Text (.txt) file of DNA Microbial Source Tracking for groundwater and surface water samples at Whihala West Beach in Whiting, Indiana USGS Water-Quality Information, USGS-National Water Information System, and producer defined. DNA_ID Laboratory sequence identifier for each sample Producer defined 1 120 Date The date on which a particular sample was collected Producer defined 2018-04-26 2018-06-25 YYYY-MM-DD (Year-Month-Day) Site_ID USGS Site Identification number U.S. Geological Survey National Water Information System (NWIS) Unique 15-digit USGS identification number Station_name USGS Station name U.S. Geological Survey National Water Information System (NWIS) Unique USGS station name Replicate Collection sequence number for samples collected at a specific site on a specific day Producer defined 1 3 HF183 Copies/100 ml Concentration of human-associated HF183 genetic markers in a replicate sample Producer defined 0 134 Copies of HF183 copy numbers per 100 mililiters of sample HF183_ND/DNQ/ROQ Descriptive indication of presence of HF183 genetic marker in a replicate sample Producer defined ND = not detected; DNQ = detected but not quantifiable; ROQ = range of quantification is accurate Gull-2 Copies/100 ml Concentration of gull-associated Gull-2 genetic markers in a replicate sample Producer defined 0 1671 Copies of Gull-2 copy numbers per 100 mililiters of sample; NA = not applicable Gull-2_ND/DNQ/ROQ Descriptive indication of presence of Gull-2 genetic marker in a replicate sample Producer defined ND = not detected; DNQ = detected but not quantifiable; ROQ = range of quantification is accurate; NA = not applicable Comments Laboratory notes detailing unusual characteristics of a replicate sample Producer defined Textual description ScienceBase U.S. Geological Survey- ScienceBase mailing and physical

Denver Federal Center, Building 810, Mail Stop 302

Denver CO 80225 United States 1-888-275-8747 sciencebase@usgs.gov Any use of trade, firm, or product names is for descriptive purposes only and does not imply endorsement by the U.S. Government. Although this information product, for the most part, is in the public domain, it may also contain copyrighted materials as noted in the text. Permission to reproduce copyrighted items must be secured from the copyright owner whenever applicable. The data have been approved for release and publication by the U.S. Geological Survey (USGS). Although the data have been subjected to rigorous review and are substantially complete, the USGS reserves the right to revise the data pursuant to further analysis and review. Furthermore, the data are released on the condition that neither the USGS nor the U.S. Government may be held liable for any damages resulting from authorized or unauthorized use. Although the data have been processed successfully on a computer system at the U.S. Geological Survey, no warranty expressed or implied is made regarding the display or utility of the data on any other system, or for general or scientific purposes, nor shall the act of distribution constitute any such warranty. The USGS and the U.S. Government shall not be held liable for improper or incorrect use of the data described and/or contained herein. Users of this data are advised to read all metadata and associated documentation thoroughly to understand appropriate use and data limitations. 20200827 Catherine A. Fargen U.S. Geological Survey, Ohio-Kentucky-Indiana Water Science Center Hydrologist mailing and physical

9818 Bluegrass Parkway

Louisville Kentucky 40299 United States 502-493-1945 cafargen@usgs.gov FGDC Biological Data Profile of the Content Standard for Digital Geospatial Metadata FGDC-STD-001.1-1999